Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0032131 | |||
Gene | PRKCH | Organism | Human |
Genome Locus | chr14:61995792-61997313:+ | Build | hg19 |
Disease | Osteoarthritis (OA) | ICD-10 | Polyarthrosis, unspecified (M15.9) |
DBLink | Link to database | PMID | 31526191 |
Experimental Method | |||
Sample Type | Peripheral Blood | Comparison | peripheral blood samples from 25 patients suffering from OA and 25 healthy controls |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward TACCTGGCTCCATGAAGATGC ReverseCCTCCTTGCACATTCCGAAG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Wang, Y, Wu, C, Yang, Y, Ren, Z, Lammi, MJ, Guo, X (2019). Preliminary Exploration of hsa_circ_0032131 Levels in Peripheral Blood as a Potential Diagnostic Biomarker of Osteoarthritis. Genet Test Mol Biomarkers, 23, 10:717-721. |